Description

Programming Assignment 5

Introduction

The aim of this assignment is to introduce you to C basics and get you familiar with Multi-D arrays. You are expected to implement a protein sequence analyser for bioinformatics.
Your DNA is made up of a series of four different nucleotides. These are adenine (A), thymine (T), guanine (G), and cytosine (C). Thymine (T) becomes urasil (U) when it comes to RNA as shown in Figure 2. Hidden within your genome lies the ”triplet code,” a series of three nucleotides that determine a single amino acid. RNA (or, more specifically messenger RNA – mRNA) serves as a copy of your chromosomal DNA and specifies the sequence of amino acids in proteins.
Proteins are large, complex molecules that play many critical roles in the body. They do most of the work in cells and are required for the structure, function, and regulation of the bodys tissues and organs. Proteins are made up of hundreds or thousands of amino acids, which are attached to one another in long chains. It had long been known that only 20 amino acids occur in naturally derived proteins.
Protein synthesis is one of the most fundamental biological processes by which individual cells build their specific proteins. It is performed in two steps. The first step is called transcription. During transcription, the information encoded in the DNA is copied to a RNA molecule as one strand of the DNA double helix is used as a template. The RNA molecule is sent to the cytoplasm, which helps to bring all components required for the actual protein synthesis together amino acids, transport RNAs, ribosomes, etc. In the cytoplasm the protein polymers are actually synthesized through chemical reactions that is why the process is known as protein synthesis or even more precisely protein biosynthesis. The second step of protein synthesis is mRNA Translation (or just Translation). The mRNA Translation step follows right after DNA Transcription (or just Transcription). The production of proteins happens during the second step of protein synthesis process the Translation. Sometimes protein synthesis process is referred only to Translation step, because no actual protein synthesis happens during the Transcription. However transcription is responsible for moving the genetic instructions from the nucleus to the cytoplasm, where the DNA/RNA code is translated by the ribosomes to a polypeptide sequence, which will later be folded into a protein.
The nucleotide triplet that encodes an amino acid is called a codon. Each group of three nucleotides encodes one amino acid as shown in Figure 1.
Examination of the full table of codons in Figure 1 enables one to immediately determine whether the ”extra” codons are associated with redundancy or dead-end codes. Note that both possibilities occur in the code. There are only a few instances in which one codon codes for one amino acid, such as the codon for tryptophan. Note also that the codon for the amino acid methionine (AUG) acts as the start signal for protein synthesis in a mRNA. Moreover, the genetic code also includes stop codons, which do not code for any amino acid. The stop codons serve as termination of the protein synthesis.

Figure 1: The amino acids specified by each mRNA codon. Multiple codons can code for the same amino acid.
AUG is an initiation (start) codon; UAA, UAG, and UGA are termination (stop) codons.

Protein synthesis is summarized in Figure 2. Part of the DNA is transcribed and mRNA is produced. Notice that the mRNA sequence starts with Metionin and ends with a stop codon. Then, the transcript is translated in to an amino acids sequence, which encodes a protein (a hypothetical one for this example).

Figure 2: Steps of the protein synthesis
The size of the proteins found in real life is very long. Therefore, hypothetical example proteins called myProteinA, myProteinB, myProteinC, myProteinD and myProteinE are created to be used in this assignment, which are seen in Table 1. Assume that these proteins are the ones known by the scientific community. The number of nucleotides in the example proteins is fixed and set to 30. Assume that they are the only known proteins by the scientific community as of today.
Table 1: Nucleotide sequences of example proteins
Protein Nucleotide Sequence
myProteinA AUGGUGGCGGAGGGGACGAAGAGGAUCUAA
myProteinB AUGGGAGAAGCAGUAAGAAAAACAAUAUAG
myProteinC AUGUUUUCCUAUUGCCUGCCACAACGCUGA
myProteinD AUGUUCUUGGUCCCUACUUACGAUCAUUAA
myProteinE AUGUUUUCCUAUUGCCUGCCAAAACGCUGA

Problem

In this assignment, you will be given a nucleotide sequence and asked i) if that sequence is one of your known proteins (myProteinA-E) or ii) to determine if that sequence might be a protein -if not a known one-.
Sample Inputs / Outputs:
The outputs of this assignment according to various input files are given in Figure 3, Figure 4 and Figure 5.

Figure 3: If the sequence given in the text file is an alternative of myProteinA-E

Figure 4: If the sequence given in the text file except myProteinA-E

Figure 5: If the sequence given in the text file is not a protein